How do I make multiple different strings using the multiple DNA sequences from one file

The contents below come from a text file,

  1. I want to read in the text file
  2. I want to make strings containing the DNA with the corresponding name automatically ex. (Rosalind_1117 = ‘CCTCCC…’)

Rosalind_1117 CCTCCCACCCGGTACCCTTCGGACCTGTCCTTCCGAGCATGGTTAATGGGACTGGTTAGG GGCGTTACTACTGACCGTAGACGCGTCATAGCGCGTGGCTTAAGTAAACCGCCTGACTCG CGTGTGCTAACACGCCAGACCTCAGGGTCAAGAGATGAAAAACTGCTGTGCCACTCTATT CGGGCTGCTATGTGCTATTCGATCGGCAGAAGCGTAGATGGAGGAACGGTGGGGGTGGGC Rosalind_7302 CAAGTGATTTCGAATCCGTTTCTATGAGTGTCCGAGGACGATACCTTACGTCTCCCATCT GTGCCTTCCGAGCGGTGCGCATAGCTGGACAAGCACAGTTGGTTGAAGAGGCGCTGACCG GTCTGGTCCTAGTGCAATATATCAGGATGCTGAGTCTGGCATTCTACAGCTATCTTTTCG CTGACTAGATCGTCTCGATTGCTACGCTATACTTGATCTAGTATAGGTGGACGAATTAAT CTCAAGCCGTTTGATTTAGCCGACCCTACTCAGTGCATCCACAGTCGCCGTAGTAGTGCC Rosalind_7642 GCACATGGACGGCGTACTACATCGATTGTAGACGGTCCTGTTGTTCGTCCGCGCGTCATC GGCCATTCATACGCAGGTCTGACCTAGCAAGCTACCCCCTAGTTGCGCGATGTAGTCGAC GGCGAAATGGCCGGGACACTAGTACCTATTACTTTAGCGACAAGGCAAACACGTGCTGTA GGGGTTCACCACGATCGTGCCCAGCCTTAGAGACGGGACGGAGAAAGCCCGCCCGAATTT

How many English words
do you know?
Test your English vocabulary size, and measure
how many words do you know
Online Test
Powered by Examplum