How can I automate a bash script that is 'read'-ing from /dev/tty?

See also questions close to this topic

• How to raise error in bash if a dir does not match certain permissions?

  How can I raise an error in bash if a directory at some path does not match the below permissions?

  u=rwX,g=rwX,o=rwX
  
• How to sort a specified column in l、Linux

  This is my two column sequence, I want to combine them into 1 column and sort them in Linux, but I don't know how to write the shell script to handle them.

      GGCTGCAGCTAACAGGTGA         TACTCGGGGAGCTGCGG
      CCTCTGGCTCGCAGGTCATGGC      CAGCGTCTTGCGCTCCT
      GCTGCAGCTACATGGTGTCG        CGCTCCGCTTCTCTCTACG
  

  The sorted results are as follows (first column first, second column second, and split by "\t")

  1 GGCTGCAGCTAACAGGTGA         
  2 CCTCTGGCTCGCAGGTCATGGC      
  3 GCTGCAGCTACATGGTGTCG        
  4 TACTCGGGGAGCTGCGG
  5 CAGCGTCTTGCGCTCCT
  6 CGCTCCGCTTCTCTCTACG
  

  what should I do？
• Update global variable from while loop

  Having trouble updating my global variable in this shell script. I have read that the variables inside the loops run on a sub shell. Can someone clarify how this works and what steps I should take.

  USER_NonRecursiveSum=0.0
  
  while [ $lineCount -le $(($USER_Num)) ] 
  do
      thisTime="$STimeDuration.$NTimeDuration"
      USER_NonRecursiveSum=`echo "$USER_NonRecursiveSum + $thisTime" | bc`
  done
  
• How to apply CSS to the input fields of only one react component?

  I am trying to apply CSS to the input fields of a react component. I have written CSS in a correspondent CSS file of a component but It is applied to input fields of other components. What can I do to apply the input field styles only for the component that I want? In the image below I have shown the code of CSS input fields of a single component
• Unity New Input system click UI elements

  My game is a 3D shooter, and the player can shoot if left mouse button is clicked.

  The problem is that I have also an UI Menu with buttons to restart the game, but I cannot click those buttons because in my action map click is equal to shoot.

  I try to disable the player input and change the current action map to none, so I can press the buttons like the old input system with the Onclick() but it doesn't work.

  At the time of displaying a Game Over screen I tried to disable the lock of the cursor.

       PlayerController.sharedInstance.GetComponent<ThirdPersonController>().enabled = false;
       PlayerController.sharedInstance.GetComponent<StarterAssetsInputs>().cursorLocked = false;
       PlayerController.sharedInstance.GetComponent<StarterAssetsInputs>().cursorInputForLook = true;
  

  I think I can start shooting raycast and check what element of the canvas is hit, and by the name of the button perform actions by I don't think this is the best idea.

  Could you tell how can I click my UI elements please?

  Thank you in advance.
• ERROR React Native - VirtualizedLists should never be nested inside plain ScrollViews with the same orientation

  I'm using a library called PhoneInput from "react-native-phone-number-input." This is the code below:

  <View>
              <SafeAreaView style={styles.wrapper}>
                <PhoneInput
                  ref={phoneInput}
                  returnKeyType="go"
                  defaultValue={value}
                  defaultCode="KW"
                  layout="second"
                  placeholder="Recipient's Number"
                  onChangeText={(text) => {
                    setValue(text);
                  }}
                  onChangeFormattedText={(phoneNo) => {
                    setRecipientPhoneNo(phoneNo);
                    setCountryCode(
                      phoneInput.current?.getCountryCode() || ""
                    );
                  }}
                  disabled={disabled}
                  textInputProps={{ returnKeyType: "done" }}
                  countryPickerProps={{ disableNativeModal: true }}
                  textInputStyle={{ height: 30 }}
                  containerStyle={styles.phoneNoCardInput}
                  inputStyle={{
                    backgroundColor: "lightblue",
                    color: "red",
                  }}
                  textContainerStyle={{ paddingVertical: 10 }}
                  withShadow
                  //  autoFocus
                />
              </SafeAreaView>
            </View>
  

  The error: VirtualizedLists should never be nested inside plain ScrollViews with the same orientation because it can break windowing and other functionality - use another VirtualizedList-backed container instead. at node_modules/react-native/Libraries/Lists/VirtualizedList.js:1115:14 in ScrollView.Context.Consumer.props.children
• i used Powershell in a script to execute and install a app in a computer remotly, I Used psexec

  well i have a little script this should execute and install one application but really in the other computer hasn't installed i'll want to install application in the other computer

  the files txt have the name of the computer yours hostname, when i execute of the script i look that my computer can connect to other computer by psexec and i can watch that appears on my screen in summary "psexec v2... - execute processes remotly, copyright, sysinternals" but after the application has not installed what i can do? i have problems in the last line

  & C:\pstools\psexec.exe -u $user -p $password \$destination\c$ $app

  $Computers = Get-content "C:\Users\marc\Documents\computer.txt"
  $destination = Get-content "C:\Users\marc\Documents\destination.txt"
  $File= "c:\Documents\program.exe"    
  $app="c:\program.exe /clone_wait /s /v' /qn PROGTYPE=ENTEGRA REBOOT=Supress'"
   
  Foreach ($destination in $Computers) {
  $Test = Test-Path -path "\\$destination\c$"
  
  If ($Test -eq $True) {Write-Host "The path exists, the software will be installed in $destination."}
  Else {(Write-Host " the path does not exist, therefore it will be created in $destination and the installation will start")}
  Echo "Copying Files to C:\$destination"
  Copy-Item $File "\\$destination\c$"
  echo "Second part : installing the software on $destination"
  
  & C:\pstools\psexec.exe -u $user -p $password \\$destination\c$ $app
  }
  
• Get duplicate users on AD server and append a suffix

  I want to append a suffix to differentiate users having same samaccountname.

  * Create new AD user
  * Get samaccountname of created user($newsam)
  * Get list of samaccountname for all users in AD ($allsams)
  * Match new samaccountname with list of samaccountname to detect accounts with duplicate samaccountnames
  * Append suffix 1 to new user samaccountname and 2,3,4.... as suffixes to others created afterward
  

  Thanks for your help!
• Script to double quotes

  I have a keyboard that does not have double quotes, when I need to use it, it's very difficult to remember the FN. How can I create a script so that when I press LShift + Escape it puts a double quote?